| ObjectiveGlycyrrhizin( GL) has various pharmacological effects such as anti - allergic , anti - inflammatory, antiviral activities.We studied the role of GL on treatment and prevention of allergic contact dermatitis(ACD)in mice. To explore the mechanism, we measured the density of epidermal Langerhans cells ( LC) in normal or lesional skin of mice. We also investigated the expression of haptoglobin mRNA in the epidermis, and the concentrations of IL - 4 and IFN - γin the blood of mice with ACD.Materials and Methods1. Animals:6 -8 week old female BALB/c mice (weight 20 ±2g)were obtained from the Laboratory Animal Center of China Medical University and Institute of Laboratory Animal Sciences of Chinese Academy of Medical Sciences.The animals were allocated into several groups randomly.1 -1 groups;Treatment before sensitizationAll the mice were treated with normal saline, different doses of GL and dexamethasone respectively, such as GL5mg/kg, GL10mg/kg, GL20mg/kg, GL40mg/kg, GL80mg/kg, Dex1mg/kg, once daily 2 hours before sensitization and 1,2 and 3 days afterwords. The mouse ear skin was excised at 1,2,3,4 days after challenging.1-2 groups: Treatment after challengingAll the mice were treated with normal saline, different doses of GL anddexamethasone respectively, once daily after challenging for 5 days. The mouse ear skin was excised at 1, 2, 3, 4 days after challenging.2-1 groups: All the mice were treated with normal saline, different doses of GL and dexamethasone respectively, once daily from 7 to 28 days. The mouse ear skin was excised at 0, 3, 7,14,21,28 days after treatment.2-2 groups: the same as 1 -1 groups2-3 groups:. There was 56 mice in this group, as a part of 1 - 2groups.All the mice were treated with normal saline, different doses of GL and dexamethasone respectively, once daily after challenging for 5 days. The mouse ear skin was excised at 1, 3, 4 days after challenging.3-1 groups: There were 126 mice in this group, as another part of 1 -2groups.All the mice were treated with normal saline, different doses of GL and dexamethasone respectively, once daily for 3 days. The mouse ear skin was excised at 24, 48 and 72 hours after challenging. The mouse ear skin was excised at 0, 24, 48, 72 hours after challenging.4-1 groups: the same as 3 -1 groupsAll the mice were treated with normal saline, different doses of GL and dexamethasone respectively, once daily for 3 days. The mouse ear skin was excised at 24, 48 and 72 hours after challenging. The blood were obtained from 6 mice at 24,48 and 72 hours after challenging.2. Establishing and Evaluation of ACD model in mice(l)Sensitization procedure:According to the literature, DNCB was applied to the flanks of the animals, 50|xl of 1% solution in acetone : Olive (4;1) of DNCB was absorbed onto 2 cm2 of the skin of the flanks. The sensitizing capacity of DNCB was assessed 5 days after the initial application by challenging the mice on the ears with 20 \il of 0.5% solution in the same solvent.(2)The effects of GL on the treatment and prevention of mice with ACD:(D Detection of thickness: The ear thicknesses of mice were detected by micrometer at 24 hours before challenging and 1, 3,7,12 days after challenging.(^Detection of weight: The ear weights of mice were detected by electronic balance.(^Detection of infiltrate cells of dermis: Cryostat sections were prepared and stained with haematoxylin and Eosin.(3)Detection of LC density in mouse epidermis(^Epidermis - dermis separation;Hie scurf on the ear skin of mouse was scraped off by knife and subcutaneous tissues and fat were eliminated from the skin. The epidermis and dermis were obtained respectively. Nipper separated the two double - deck skins after PBS washing. The ear skin was incubated in EDTA for 1 h at 37^. Then the epidermal and dermal sheets were prepared from mice.(^Detection of density of LC — Immunohistochemical (IH)Procedure;At selected time points after the treatment punch biopsies (4mm) were taken from the ear skin. The ear skin was incubated in EDTA for 1 h at 371. Then the epidermal sheets were prepared from mice. The epidermis sheets were fixed in acetone for 10 min at room temperature. The sections were washedvwith phosphate buffered saline (PBS) for 10 min at room temperature. Then incubated with Rat anti mouse H - 2 I - A antibody overnight at 4*^. Sections were washed" three times with PBS. Section were then consecutively incubated with Goat anti rat IgG: HRP secondary antibodies for 1. 5h at 37*0. The sections were washed" three times with PBS. The final incubation was in 3 - ami-no -9 - ethylcarbazole (AEC) for 30 min at room temperature.Results of Immunohistochemistry: Only dendritic cells exhibiting a brightly stained cytoplasm with cell body were positive and were counted.(4)Detection of Hp mRNA expression in mouse epidermis with ACDODSemiquantitive RT - PCR procedureTotal RNA was isolated from epidermis and dermis of mouse by Trizol reagent, according to the manufacturer's procedures. According to the instructions of RT - PCR kit. PCR products were electrophoresed on 1.5% agarose gels stained with ethidium bromide. The ethidium bromide stained PCR products were quantified by densitomery using FlourChem Gel Imaging System. The results were expressed as the ratio between the amounts of the haptoglobin ampli-cation product over the internal control, (3 - actin amplication product for each sample. The ratios were called Hp relative transcript or mRNA levels. Each denstiometric value was calculated as an average of four independent RT -PCRs. Experiment was conducted under identical conditions.Detection of PCR products: Hie amplication products were eletrophoresised in 1.5% gel and scanned by ultraviolet image system. Fluoro Chem Gel Imaging System analyzed the results. The gray value of every target DNA ratio to the gray value of its control p - actin were confirmed as the level of mRNA.d)In Situ Hybridization (ISH) :According to the instructions of Haptoglobin in situ hybridizatio kit. The sequences of Hp probes as follows: upstream 5' - ACCTTAAACGACGAGAAG-CAATGG - 3';Downstream 5' - AGCCAGACACGTAGCCCACACG - 3'.Results of ISH: Staining with orange in the cytoplasm was determined as positive. The intensity were divided into five degrees: ( - ) no staining ( ± ) weak staining ( + ) moderate staining ( ++ ) strong staining ( +++ ) very strong staining.(S)Detection of IL -4 and IFN - y in the blood of mice with ACDEnzemy - Linked Immunoabsorbant Assay (ELISA) : Add 50|xl Assay Diluent to each well. Add 50ui Standard, control , or sample to each well and tap plate gently for one minute. Cover the plate and incubate for 2 hours at room temperature. Aspirate and wash each well five times. Add IOOjxI Conjugate to each well. Cover the plate and incubate for 2 hours at room temperature. Aspirate and wash each well five times. Add 100|xl Substrate solution to each well. Incubate 30 minutes at room temperature. Add lOOuJ stop solution to each well. Read Optical Density at 450nm. The concentration was read at 450nm in a model 550 Microplate Reader, using Microplate Manager version 4;0 software.Results of ELISA: The Optical Density was changed into the concentration through stand curve by using Microplate Manager Version 4.0 software.3. Statistical analysisStudent' s t test was performed, and a p value less than 0. 05 were conci-derd to be statistically significant.Results1. The effects of GL on the treatment and prevention of mice with ACD:(1) 1 -lgroups:The difference of thickness at 24 hours before and after challenging of left ear of mice treated with GL lOmg /kg and dexamethasone lmg/kg were lower than those of saline. The difference of thickness between left and right ear of mice treated with GL lOmg /kg and dexamethasone were lower than those of normal saline at 1, 3, 7, 12 days after challenging.The difference of weight between left and right ear of mice treated with different dose of GL and dexamethasone lmg/kg were lower than those of normal saline at 1, 3,7,12 days after challenging.The dermal edema and densities of dermal infiltrating cells in groups treated with GL lOmg /kg and dexamethasone were lower than those of normal saline at 1,3,7 and 12 days after challenging.(2)1 -2groups:The difference of thickness at 24 hours between before and after challenging of left ear of mice treated with GL 5mg/kg and GL lOmg /kg and GL 20mg /kg and dexamethasone lmg/kg were lower than those of saline. The difference of thickness between left and right ear of mice treated with GL 5mg/kg and GL lOmg /Jtg and GL 20mg /kg and dexamethasone were lower than those of normal saline at 1 and 3 days after challenging. The difference of thickness between left and right ear of mice in groups treated with GL lOmg /kg and dexamethasone were lower than those of normal saline at 7 and 12 days after challenging.The difference of weight between left and right ear of mice treated with different dose of GL and dexamethasone were lower than those of normal saline at 1, 3, 7, 12 days after challenging. The dermal edema and densities of dermal infiltrating cells in groups treated with GL5mg /kg, GL lOmg /kg and dexamethasone were decreased than those of normal saline at 1, 3, 7 and 12 days after challenging.2. Detection of LC densities in mouse epidermis with ACD(l)The effect of GL on Langerhans Cells of normal mice2-1 groups: The LC densities in groups treated with GL 5 mg /kg and lOmg/kg and dexamethasone 1 mg /kg were lower than those of pre - treatment and control group treated with saline after 3 and 7 days of treatment. The LC densities in groups treated with GL 80 mg /kg were higher than those of pre -treatment and control group treated with saline after 3 and 7 days of treatment. The LC densities in groups treated with GL5 mg /kg were lower than those of pre - treatment and control group after 7 days of treatment. Then the LC densities rose again after 14 days of treatment and got back those of pre - treatment level. The similar changes happened in group treated with GLIOmg/kg. Trie LC densities in groups treated with GL80 mg/kg were higher than those of pre - treatment and control group after 7 days of treatment. The LC densities got back to the level of pre - treatment after 14 days of treatment. The LC densities in groups treated with dexamethasone 1 mg /kg were continuously lower than those of pre -treatment and control group after 21 days of treatment and then the LC densities remained in this level.(2)1116 effect of GL on LC densities of mice with ACD2-2 groups: The LC densities in groups treated with GL lOmg /kg and dexamethasone were decreased than those of normal saline at 1, 3, 7 and 12 days after challenging.2 -3groups;The LC densities in groups treated with GL 5mg /kg were decreased than those of normal saline at 1 and 3 days after challenging. The LC densities in groups treated with GL lOmg /kg were decreased than those of normal saline at 1, 3, 7 and 12 days after challenging.3. Detection of Hp mRNA expression in mouse epidermis with ACD3 -1 groups: The Hp mRNA expression in groups treated with GL 5 mg /kg and GL lOmg/kg and dexamethasone 1 mg /kg were increased than those of normal saline at 24 and 48 hours after challenging. The Hp mRNA expression in groups treated with GL 80 mg /kg were decreased than those of normal saline at 24 and 48 hours after challenging. There was no Hp mRNA expression in epidermis at 72 hours after challenging. There was no HpmRNA expression in der-pus.4. Detection of EL -4 and IFN - y in the blood of mice with ACD4-1 groups: The concentration of IFN - *y in groups treated with normal saline, different doses of GL and dexamethasone respectively were decreased than those of normal saline at 24 ,48 and 72 hours after challenging.The concentration of IL - 4 in groups treated with GL 5 mg /kg and GL lOmg/kg were decreased than those of normal saline at 24, 48 and 72 hours after challenging. The concentration of IL -4 in groups treated with GL 80mg /kg and dexamethasone were increased than those of normal saline at 24, 48 and 72 hours after challenging.Conclutions1. The thickness and weight of mice of allergic contact dermatitis can be decreased by GL. Allergic contact dermatitis of mouse can be treated and prevented by GL.2. The LC densities in normal mouse epidermis can be regulated bidirec-tionally by GL. The LC densities may be decreased by lower dose, but increased by higher dose of GL treatment. The LC densities in ACD mice can be decreased byGL.3. The Hp mRNA expression of mice with ACD can be regulated bidirec-tionally by GL. The expressions of Hp mRNA may be increased by lower dose, but decreased by higher dose of GL treatment.4. The concentration of IFN - *y of the blood of mice with ACD can be decreased by different dose of GL. The concentration of IL -4 of the blood of mice with ACD can be regulated bidirectionally by GL. The concentration of IL - 4 may be decreased by lower dose, but increased by higher dose of GL treatment.
|
PDF Full Text Request