| Alfalfa(Medicago sativa L.)is a forage legume of world-wide importance used in agriculture.To analysis the molecular genetic diversity of alfalfa varieties is of great interesting for breeding programmes and germplasm conservation.In this paper,RAPD (dominant)and SSR(codominant)markers were used to analyze the genetic diversity of 16 alfalfa cultivars,which included 6 local varieties(Longdong,Tianshui,Longzhong, Qingyang,Hexi and Dingxi),6 breeding varities(line)(Gannong 1,Gannong 2, Gannong 3,Zhonglan 1,Gongnong 1 and Ganza)and 4 introduced varioetis(Jindera, Algonuin,Queen and Graze401+z).One objective of this paper is to estimate the genetic diversity of cultivated populations of alfalfa from Gansu province.Another objective of this paper focused on achieving sequence characterized amplified region(SCAR)of cultivated populations of Medicago sativa,and the study on transferring RAPD specific bands of 5 varieties to SCAR markers was conducted.The results of this paper were as below:1)Ten out of 20 RAPD primers were selected,and individual plant DNA was used to analyse the genetic diversity of 16 alfalfa varieties.A total of 146 discernible loci obtained for all populations using 10 primers,and 81.1%of these loci were polymorphic (117 loci),which indicated that a high diversity existed in the cultivars from Gansu Province.The loci amplified per plant were from 8 to 18 and the average loci was 14.6, while the loci amplified by 10 primers were from 6-16 and the average loci was 10.7. The percentage of polymorphic loci amplified by 10 primers was between 62-88.9%, which indicated that distinctive differences existed among these primers.According to the Roger's distance,the smallest MRD(0.3397)occurred between combinations 'Graze 401+z×Queen',while the largest(0.6279)was obtained for 'Jindera×Longzhong'.The result of AMOVA analysis showed that the majority of genetic variation was within populations(60.47%)as well as 39.53%of the genetic variation among populations,which indicated that the genetic differentiations in alfalfa populations was not so obviously.The UPGMA dendrograms based on the RAPD analysis showed that 16 alfalfa populations were divided into four groups.There was a clear difference between creeping variety Jindera and other erect varieties.Within the erect accessions,3 distinct groups including one introduced varieties and synthetic varieties originated from alien germplasm,one east-central group and one west group,were detected.The dendrogram by UPGMA cluster analysis showed that the relationships among these cultivars were tight related to geographic distribution and breeding programs.2)The objective of this study was to evaluate the genetic diversity of alfalfa varieties, and to identify them through screening the variety-specific primers.This report analyzed the genetic diversity of 16 alfalfa varieties from Gansu Province based on RAPD markers using bulking equal quantities of DNA from 20 individuals of a cultivar.Four out of 10 primers,OPE-4,OPE-5,OPE-6 and OPE-7,amplified the specific bands belong to 5 cultivars,Gannong 3,Ganza 27,Jindera,Longdong and Algoniun,were detected respectively.Based on the results of RAPD study of alfalfa populations,DNA fragments of Gannong 3,Ganza 27,Jindera,Longdong and Algoniun above were recycled,purified, pUCm-T vector cloned and sequenced.The homologous sequence comparison with Medicago trunctula showed that percentage of OPE6-Longdong to Medicago trunctula was highest(84%)and two paris of primers were designed:P1.1(5′GAACACTGGGATACCCAAGATG 3′)and P1.2(5′CAAGTTAGTGGGCCCAGTGTC 3′)..The problems existed in the process of RAPD specific bands transferring to SCAR markers were discussed,and the possibility to identify alfalfa variety through exploring the variety-specific SCAR marker will be investigated furtherly.3)Using individual-SSR strategy,four out of 8 pairs of SSR primers were selected to analyze genetic diversity of 160 individual plants of 16 alfalfa varieties.The results showed that a total of 12 alleles were detected.The number of alleles per locus averaged 3 and ranged 2-4.The value of polymorphic information content was between 0.17-0.99 and averaged 0.79.The result of AMOVA analysis showed that genetic variation within and among populations were 87.98%and 12.02%,respectively,which was accordance with the result of RAPD.The UPGMA dendrograms based on the SSR analysis showed that 16 alfalfa populations were divided into four groups but it was not as same as the UPGMA dendrograms based on the RAPD markers. |