Font Size: a A A

Specific Expression And Significance Of Human Wings Apart-Like (hWAPL) Gene In Cervical Carcinoma

Posted on:2008-10-01Degree:MasterType:Thesis
Country:ChinaCandidate:X Q LuFull Text:PDF
GTID:2144360215961148Subject:Obstetrics and gynecology
Abstract/Summary:
Background and ObjectiveCervical cancer is the most common gynecologic malignant disease. Cervical cancer has been the second dead cause about cancer in women. Recently, the morbidity of cervical cancer tends to be rising and younger with the rising of sexually transmitted diseases.hWAPL gene discovered recently is over-expressed in cervical cancer specially, and has the characteristics of oncogene. hWAPL gene which is 30,793bp and located in 10q23.2. is a human homologue of WAPL gene in Drosophila melanogaster. It can encode a a cohesin-binding protein that facilitates cohesin's timely release from chromosome arms during prophase. hWAPL gene's mechanism of action is not clear. But over-expression of WAPL causes premature separation of sister chromatids.To our knowledge no messages are reported about the expression of hWAPL gene in cervical cancer in China till now. In the present study, we tried to investigate the expression of hWAPL gene in cervical cancer of Chinese women, and analysis its significance and relationship with occurrence and development of cervical cancer.Part 1 the detection of hWAPL protein expressionMaterials and Methods413 paraffin sections were detected by immunohistochemistry PV-9000. The examples included 27 cases of benign squamous epithelia, 47 cases of cervical cancer, 30 cases of cervical intraepithelial neoplasia(CIN)I, 33 cases of CINII, 38 cases of CINIII, 29 cases of gastric cancer, 28 cases of carcinoma of the liver, 26 cases of bladder carcinoma, 35 cases of carcinoma of esophagus, 25 cases of carcinoma of endometrium, 23 cases of renal carcinoma, 36 cases of carcinoma of the rectum and 33 cases of lunger cancer.Immunostaining results were scored for the relative immunostaining intensity and appropriate percentage of positive tumor cells. Staining intensity was graded on 0 to 3 scale i.e., 3+ for buffy particles, 2+ for yellow particles 1+ for amber particles; 0 for no staining. The extent of the staining scored as follows: 6%~25% of tumor cells stained (1); 26%~50% of the tumor cells stained (2); 51%~75% of the tumor cells stained (3); and≥76% the tumor cells stained (4). Intensity and extensity and extent of staining scores were muitiplied with the maximum score being 12. It was positive case whose score was more than 2. The data was analyzed by SPSS10.0 statistical software. Analysis of variance were used for the statistics of staining score. Chi-square test were used for the statistics of positive rate,α=0.05 was considered significant.ResultsSome light staining existed in epithelialis' kytoplasm in basilar part in benign squamous epithelia. The staining were more deeper and positive staining cells were rising with the getting worse of cervix. There were full of deep staining in all of epithelialis' kytoplasm in cervical cancer.No yellow staining or a few light staining was in epithelialis' kytoplasm in gastric cancer, carcinoma of the liver, carcinoma of endometrium, renal carcinoma, carcinoma of the rectum and lunger cancer. Some samples had light staining in bladder carcinoma, carcinoma of esophagus.The staining score of hWAPL gene in cervical carcinoma (x±s, 6.49±2.54) was statistically different from CINIII (4.89±1.67), P<0.001. The score was significant higher in CINIII than in CINI (2.45±1.06) and CINII (2.20±1.19), P<0.001, respectively. The score of CINI and CINII were near. The difference of staining score were obvious between CINI and benign squamous epithelia (0.52 + 0.70),P<0.001.The positive rate of hWAPL gene was step up from benign squamous epithelia, CINI, CINII, CINIII to cervical cancer, 3,70%,40.00%,42.42%,89.47% and 97.87%, respectively. The positive rate of hWAPL gene in cervical cancer was higher than benign squamous epithelia, CINI, CINII and CINIII (P<0.001) .The expression of hWAPL gene were negative in gastric cancer, carcinoma of the liver, carcinoma of endometrium, renal carcinoma, carcinoma of the rectum and lunger cancer. The expression were weak in a few of examples of bladder carcinoma and carcinoma of esophagus. Their positive expression rate were 11.54% and 14.28%, respectively.Part 2 the detection of hWAPL mRNA expressionMaterials and MethodsQuantitative real-time PCR was used to analysis the hWAPL mRNA's expression in 8 benign squamous epithelia and 11 cervical cancer.A humanβ-actin gene is controls. Real-time PCR used theβ-actin-special primers 5'ATCATGTTTGAGACCTTCAACA3 ' and 5CATCTCTTGCTCGAAGTCCA3 ' and hWAPL-special-primers 5 ' AATTGTCGAGCACTGATAGAG3' and 5' TTAAGTCAGCCTCAAGTACCC3' . Reaction mixtures were denatured at 94℃2min 35 cycles and then 94℃, 30s, 58℃, 30s, 72℃, 40s. Every samples had 2 equals and 2 blank. According to the Cts and standard curve from computer, the content of hWAPL mRNA was calculated by hWAPL copies/β—action copies. The data was analyzed by SPSS10.0 statistical software, t test was used for the statistics of hWAPL mRNA, andα=0.05 was considered significant.ResultshWAPL mRNA in Cervical cancer (x±s,11.16±1.097) was significant higer than in benign squamous epithelia (1.81±0.58) , P<0.001.ConclusionhWAPL gene was over-expressed only in cervical cancer. The quantity of hWAPL were rising to accompany with the development of the cervical lesion.hWAPL was over-expression in cervical cancer compared with benign squamous epithelia.
Keywords/Search Tags:hWAPL gene, cervical cancer, CIN, immunohistochemistry, Quantitative real-time PCR
Related items