Somatostatin(SST) is secreted by the D cell of gastrointestinal tract.It is a small cyclic peptide in two biological active forms:SST-14,consisting of 14 amino acids and SSt-28,consisting 28 aminoacids.SST is formed by proteolytic processing of larger precursor molecules:prepro-SST and pre-SST.SST inhibits a variety of physiological functions in the gastrointestinal tract,such asgastrointestinal motolity, gastric acid production,pancreatic enzyme secretion and bile secretion.It also inhibits the secretion of pancreatic and intestinal hormones such as insulin,glucagons, secretin and vasoactive intestinal peptide.In addition to playing an important role in neurotransmission and secretion,SST may control cell proliferation in normal tissues and tumors.SST mediates its actions by interacting with a family of somatostatin receptors (SSTR).SSTR consists of five subtypes named as SSTR1,SSTR2,SSTR3,SSTR4 and SSTR5 respectively,and belongs to the superfamily of G protein-coupled receptor (GPCR).The genes encoding the five subtypes are located on different chromosomes. Two forms of the SSTR2(SSTR2A and SSTR2B) can be generated through alternative splicing.The relationship between gastric cancer development and SSTR expression spectrum has been little reported,related papers are mainly study on gastric cancer and single SSTR subtype.Few studies on transcriptional factors and target genes mediating SST anti-proliferative action have been found.ZAC(zinc finger protein which regulates apoptosis and cell cycle arrest) is a zinc finger transcriptional factor that reveals transactivation and DNA-binding activity.ZAC inhibits tumor cell growth through induction of apoptotic cell death and G1 arrest.In this study,the immunohistochemical technique was used to observe expression SST and ZAC in gastric cancer,adjacent cancer and normal gastric mucosa tissues.RT-PCR was used to demonstrate expression spectrum of SSTR in the tissues above mentioned.The data was used to explore correlation of SST with ZAC expression in gastric cancer tissues,and correlation of clinicopathological factors of gastric cancers with SST,SSTR and ZAC.expression.Materials and methods1.Materials Each specimen of 90 cases including 30 cases of gastric cancer,30 cases of adjacent cancer and 30 cases of normal gastric mucosa was divided into two parts.Specimens used in RT-PCR were frozen in liquid nitrogen,and those used in immunohistochemistry were paraffin embedded.2.Immunohistochemistry SABC technique was taken according to the instruction of the kit.ZAC immunoreactive signals were demonstrated by streptavidinperoxidase -DAB system,and SST signals were demonstrated by streptavidinperoxidase -AEC system.The specirnens incubated with PBS substituting first antibody were used as negative control.All specimens were stained with hematoxylin to demonstrate nucleus.3.RT-PCR Primer SSTR1:sense,AGCCGGTTGACTATTACGCC, antisense,GCTCTCACTTCTACCATTGTC;SSTR2:sense,GGTGAAGTCCTC TGGAATCC,antisense,CCATTGCCAGTAGACAGAGC;SSTR3:sense, TCATCTGCCTCTGCTACCTG,antisense,GAGCCCAAAGAAGGCAGGCT; SSTR4:sense,CGGCAGTCTTCGTGGTCTAC,antisense,GCATCAAGGCTG GTCACGAC;SSTR5:sense,AACACGCTGGTCATCTACGTGGT,antisense, AGACACTGGTGAACTGGTTGAC.50℃,30min;94℃,2min;94℃,30s; 60℃,30s;72℃,30s;10cycles.94℃,30s;55℃,30s;72℃,40s;25个cycles.72℃,2 min.Amplified products were run on 1.5%agarose gel to demonstrate results.4.Statistical analysis The data were analyzed by SPSS10.0 statistical software, and P<0.05 was used as test level.Results1.SST positive rate in gastric cancer,adjacent cancer and normal gastric mucosa tissues was 36.7%(11/30),53.3%(16/30)and 73.3%(22/30) respectively.SST positive rate in gastric cancer tissues was obviously lower than that in normal gastric mucosa tissues(P<0.05).2.All five SSTR subtypes were expressed in gastric cancer tissues with various positive rates.The positive rate of SSTR1,SSTR2,SSTR3,SSTR4 and SSTR5 was 40.0%(12/30),73.3%(22/30),33.3%(10/30),53.3%(16/30) and 56.7% (17/30) respectively.The positive rate of SSTR2 positive rate was the highest,and that of SSTR3 was the lowest.3.The positive rate of SSTR3 in gastric cancer tissues was obviously lower than that in normal gastric mucosa tissues(P<0.05).However,the positive rate of SSTR2 and SSTR5 was significantly higher than that in normal gastric mucosa tissues(P<0.05).There was no significant difference between the positive rate of SSTR1 and SSTR4 in gastric cancer tissues and that in normal gastric mucosa tissues(P>0.05).The positive rate of SSTR3 in well differentiated gastric cancer tissues was significantly lower than that in poorly differentiated gastric cancer tissues (P<0.05).4.ZAC was expressed in gastric cancer,adjacent cancer and normal gastric mucosa tissues with various positive rates.The positive rate of ZAC in gastric cancer, adjacent cancer and normal gastric mucosa tissues was 33.3%(10/30),73.3% (22/30) and 66.7%(20/30) respectively.The positive rate of ZAC in gastric cancer tissues was obviously lower than that in normal gastric mucosa tissues.ZAC expression in well differentiated gastric cancer tissues was obviously lower than that in poorly differentiated gastric cancer tissues(P<0.05).ZAC expression was related to infiltration degree(P<0.05),however,which was not related to lymph node metastasis(P>0.05).5.A significant correlation occurred between ZAC expression and SST expression in gastric cancer tissues(P<0.05).ZAC/SST coexpression in well differentiated gastric cancer tissues was obviously lower than that in poorly differentiated gastric cancer tissues(P<0.05).There was a significant difference between ZAC/SST coexpression in the gastric cancer tissues with or without serosa infiltration(P<0.05).No significant difference was found between ZAC/SST coexpression in the gastric cancer tissues with or without lymph node metastasis (P>0.05).Conclusion1.All five SSTR subtypes were expressed in gastric cancer tissues with various positive rates.The positive rate of SSTR2 positive rate was the highest,and that of SSTR3 was the lowest.2.Both ZAC and SST expression in gastric cancer tissues are significantly lower than that in normal gastric mucosa tissues.A significant correlation occurs between ZAC expression and SST expression in gastric cancer tissues.3.SST may affect ZAC expression mediated by interacting with its receptors to regulate growth and differentiation of gastric cancer cells.
|