Silence Of FNBP1 Induces Morphological Remodeling Of HEPG2 Cells

Objective: Selected the effective siRNA-FNBP1 and transfected which into HepG2 cells to observe the changes in cell morphology, cell viability and cell cycle.Methods: To validate the expression of FNBP1 in HepG2 cells by gene chips,RT-PCR and western blot; 3 guoups of siRNA- FNBP1 and one group of negative control was synthesized and transfected into HepG2 cells. Selecting the most effective group by RT-PCR and transfected that into HepG2 cells, detected the efficiency of RNAi through RT-PCR and western blot; Observe the morphous changes , cell viability and cell cycle changes using HE stain, XTT and FCM.Results: After identification by RT-PCR and Western blot, it was sure that FNBP1 express steadily in HepG2 cells; the most effective siRNA was 5'- CCCACUUCAUAUGUCGAAGUCUGUU - 3', and it could knockdown of the endogenous FNBP1 completely . The morphological remodeling was triggered from epithelioid to tree-like branched fibrous shape after the endogenous FNBP1 was knockdown, while the cell viability and the cell cycle had no significant change. Conclusion: In the present exploration, it was curiously found that knockdown of the endogenous FNBP1 with RNA interference technology (RNAi) triggered the morphological remodeling of HepG2 cells from epithelioid to tree-like branched fibrous shape, which strongly indicated that FNBP1 might also play an important role in morphogenesis. It was inferred that FNBP1 governed the cell shape possibly by molecular regulation of actin cytoskeleton assembly from the known FNBP1 protein-protein interactions.