| ObjectPTEN mutation appears highest frequency in endometrial carcinoma. The exon 5 and 8 were analyzed for PTEN mutations in 31 carcinomas and 10 normal endometrium in women by the PCR - SSCP analysis.Materials and MethodsAll of the specimens were snap - frozen in the surgical pathology unit at the 2nd hospital of CMU- Tumors were staged according to the criteria proposed by International Federation of Gynecology, including stage I 19 cases, stage II 7cases, stage III 4cases, stage IV leases; G120cases, G2 8cases, G3 3cases . All the DNA was taken out by standard programs. PCR Amplification. For each subtraction, two PCR amplifications were performed. The primary PCR reaction in 25 ul contained 1 ul of subtracted cDNA, 1 ul of PCR primer exon5 5' - ACCTGTTAAGTTTGTATGCAAC - 3 ' , 5 ' - TCCAGGAAGAG-GAAAGGAAA - 3 ' (339bp) , exonS 5 ' - CTCAGATTGCCTTATA-ATAGTC - 3 ' , 5 ' - TCATGTTACTGCTACGTAAAC - 3 ' ( 558bp), and 0. 5ul each of 50ulJ advantage cDNA polymerase mix ( Clontech) and 10 mM dNTP mix. The cycling parameters were 75℃ for 7 min, followed by 35 cycles at 94℃ for 5 min, 55℃ for 1min, and 72℃ for 1 min. The amplified products were diluted 10 - fold with deionized water and 2 jxl were used in the secondary PCR reactions with NP1and NP2 primers ( provided in the kit). The cycling conditions were the same as in the primary PCR amplification, except the reactions were in a 50ul volume for 11 cycles only, with a final extension cycle for 10 min at 72C. Single - strand Conformation Polymorphism Analysis PCR products were diluted 1:1 with loading buffer (95% for-mamide, 0.05% xylene cyanol) , denatured for 5 min at 95C, and then cooled on ice. 10 ul of each sample were electrophoresed using precast 12.5% acrylamide gels, buffer strips, and GenePhor electro-phoresis unit . Silver staining was then performed using Hoefer automated gel stainer (Pharmacia Biotech) with PlusOne DNA silver staining kit (0.2% silver nitrate, 0.7% benzene sulfonicacid; Pharmacia Biotech). Aberrant bands revealed by single strand conformational polymorphism analysis were excised.Statistical Analysis. Analysed by chi - squared test and exact test using the SPSS 11.5.Results10 PTEN mutation appeared in 31 endometrial carcinoma, the mutation rate is 32. 2% , no PTEN mutation happened in 10 normal endometrium, P < 0. 05. The PTEN mutation rate in G1, G2 - G3 grade is 45. 0% and 9.1% , P <0. 05. 9 PTEN mutation appeared in 25 adenocarcinoma, the mutation rate is36. 0%. 1 PTEN mutation appeared in 6 other type of endometrial carcinoma, the mutation rate is 16.7% , P >0. 05. The PTEN mutation rate in I , II ,III - IV stage is 33. 3% ,28. 3% and 20. 0% , P > 0. 05 . The PTEN mutation rate in infiltration of muscular layer of < 1/2,> 1/2 is 37. 5% and 14. 3% , P >0. 05. The PTEN mutation rate of exon5 and 8 is 16.1% indifferent cases, and they did not appeare in same case, and there is no significant difference between the exon 5 and exon 8 in histological type, staging, grade and infiltration.DiscussionA new gene was found on the 10q23. 3 by Li ect in 1997, which was named as Phosphate and Tensin homolog deleted on chromosome ten, PTEN. PTEN has 9 exon , and code a cytoplasm protein consisted by 403 aminoacid. It takes an important role in cytoadhesiveness and immigration by controlling the cell cycle and taking effect to the apoptosis. PTEN acts as a negative regulator of the phosphoinositide 3 - kinase ( PI3 K) signaling pathway by dephosphorylating the second messengers phosphatidylinositol -3,4,5 - trisphosphate [ PtdIns (3, 4,5 ) P3 ] and phosphatidylinositol - 3 ,4 - bisphosphate [ Ptdlns ( 3 , 4)P2] at the D3 position of the inositol ring, thereby opposing PI3K function. PTEN controls the expression of gene, it takes negative effect to the cell growth.In addition, PTEN makes FAK and ShC to be dephosphorlated, hinders the dhesiveness, infiltration, and the integrin mediated cell spreading and local adhesiveness. PTEN inactivation includes allele deletion, mutation, methylation, decrease of mRNA or p... |