The Expression Of The Human Telomerase Reverse Transcriptase In Preeclampsia Placenta

Background:Preeclampsia (Preeclampsia, PE) is a kind of special pregnancy disease, with multisystem function disorder, blood pressure raise、urine protein level elevated, and edema as the main clinical characteristics, is one of the main reasons of the increasing death of maternal and perinatal infants. According to degree of the blood pressure and proteinuria etc, preeclampsia can be divided into mild preeclampsia and severe preeclampsia, especially severe preeclampsia, is a serious threat for mother and perinatal infants. At present, the exact causes and the pathogenesis of preeclampsia is still not clear, it is not a single cause disease, may be the result of the interaction of the various factors, the characteristic pathological physiological changes of PE is the spiral artery recasting failure and placenta shallow implantation,endothelial cell injury, excessive inflammation,that is caused by the trophoblast prosoplasia, it plays an important role in different stages of the development of PE. The placenta forming defects is considered to be the source of preeclampsia, the placenta is an important intermediary organs between maternal and fetal, rely on the invasion of thophoblast to the uterus substrate and blood vessels, eventually form the placental blood supply to Embryo for ensure the normal development of embryos. The proliferation, differentiation and apoptosis of trophoblast play an important role in placenta formation and development. The reasons of the low trophoblast erosion ability in preeclampsia are still not clear, immune factors and oxidative stress factors which can lead to the abnormal of trophoblast proliferation, differentiation and apoptosis and invasion, through the biology research on the placenta/trophoblastic to understand the cause of pathophysiological mechanism in preeclampsia is necessary.Telomerase is a ribonucleoprotein, via the primer specific recognition sites, use their own RNA as templates to synthetize telomere DNA in chromosomal end, and make telomere prolonged for the synthesis of complete chromosome by the subsequent DNA polymerases providing platform, offset or postpone the telomeres shortening with cell division, to extend the cells lives and even make them immortalization. Under the catalysis of their own human telomerase reverse transcriptase (hTERT) catalytic unit, telomere progressive shortened with the cell division, so it plays an important role in the cell proliferation and apoptosis. Trophoblast has the unique ability of rapid proliferation and invasion into the uterine wall, the ability to give similar characteristics of the placenta to tumor. The placenta telomerase has higher activity during early pregnancy, it drops with the progress of the pregnancy, propose that adjusting of telomerase activity in a normal pregnancy play an important role in the placenta ageing process, may be related to placenta apoptosis. Telomerase expression is closely related to is villus trophoblast proliferation and apoptosis, may be the main reason for placenta trophoblast invasion abnormal in preeclampsia.Basic fibroblast growth factor mainly promote angiogenesis through the direct silk crack role of the endothelial cells, bFGF can induce endothelial cell hyperplasia and migration in body. In the early, middle and late pregnancy, bFGF expression in placenta trophoblastic is gradually weakened. BFGF may be related to the trophoblastic proliferation, differentiation and transfer function, may be the main reason for placenta trophoblast invasion abnormal in preeclampsia.AbjectiveThrough the observation of pathology change in preeclampsia placental tissue, discusses the pathologic basis of ischemia and anoxic in placenta preeclampsia; Through testing the expression level of the placental tissue hTERT, bFGF protein and mRNA in the term preeclampsia and normal pregnancy group, and in the preterm severe preeclampsia and pretern pregnancy group, understanding the placental tissue hTERT, bFGF protein and the mRNA expression level and differences between the preeclampsia and normal pregnancy, discuss the relation between the placenta hTERT and bFGF expression level and the oncome of preeclampsia.Materials and Methods1、Material sourceSelect72pregnant women from Shenzhen Maternity and Child Healthcare Hospital, according to the preeclampsia diagnosis standard of the journal of obstetrics and gynaecology "7th Edition, selecting29patients with full term preeclampsia pregnant women, it including severe preeclampsia16examples, mild preeclampsia13examples, and term pregnant women16examples with no complications for control group; Select14patients with preterm preeclampsia pregnant women for disease group, and select preterm pregnant women13examples with the corresponding gestation to preterm preeclampsia pregnant women, the preterm group women with no complications for control group. During each group, the pregnant women age, gestational age and pregnancy production time was not statistical different.2、The experimental method(1)The placenta morphology research:after the delivery of the placenta, randomly cut off2piece of the placenta,the size is about1.0cm×1.0cm×1.0cm, put in10%Formalin liquid (Formalin) fixed24to48hours, paraffin embedding, randomly continuous biopsies take4um thickness for HE colouration. Under40times microscope, observe the syncytiotrophoblast cell nodule increase, the cell proliferation,trophoblast proliferation, fibrinoid necrosis and villus blood vessels reduce or congestion and of each slice.(2) Immunohistochemical:After the delivery of placenta, randomly cut off several pieces of the placenta central belt (umbilical cord offside to the matrix surface), the size is about1.0cm x1.0cm x1.0cm, pay a attention to avoid calcification, necrosis parts, make and slices of wax as the placenta morphology research method, using SP method to detect the placenta hTERT and bFGF protein expression, finally using the microscope observe the orientation, distribution, and dyeing strength of the hTERT immunohistochemical reaction. using IPP6.0Image-pro plus to analysis the colouration signal in the slice. Positive cells performance as organization cellular structure is clear under microscope, the cell cytoplasm and (or) matrix have obvious brown particles composure, dyeing was significantly higher than the background. The no dyeing or the color is the same to background as negative cells. under400times microscope, randomly select five vision of each slice, analyzing the gray value of each view cells, gray refers to the color depth of point in the black and white image, generally range from0to255, white for255, black is0, the bigger of the grey value is, the dyeing is lighter, so, here we use standard deviation (x±s) of an average background gray values-the picture of the grey value to expression the signal strength, to reflect hTERT expression level, the bigger the difference is, the dyeing is deeper.(3) RT-PCR:After the placenta delivered, randomly cut off several pieces of the placenta central belt (umbilical cord offside to the matrix surface), the size is about1.0cm x1.0cm x1.0cm, pay attention to avoid calcification, necrosis parts, Placental tissue rinse clean in the physiological saline, remove the blood, absorb apparent moisture in dry gauze, take about500mg into the EP tube with inactivated RNA enzyme, put into nitrogen for inactivated and then-80℃refrigerator save, according to the High Purity Total RNA Rapid Extraction kit specifications, extract RNA from placenta specimens under aseptic conditions, the target gene hTERT forward primer and reverse primer sequence are gccttcaagagccacgtc and ccacgaactgtcgcatgt respectively, and the reference gene is P-action, its forward primer and reverse primer sequence are ccaaccgcgagaagatga and ccagaggcgtacagggatag respectively, using fluorescence quantitative RT-PCR detection the expression of hTERT mRNA in the placenta. according to the following formula compute the samples hTERT mRNA relative express quantity:ΔCT (purpose gene)=purpose gene CT-reference gene CT, Δ ΔCT=ΔCT(purpose gene)-ΔCT (standard), the relative quantum of purpose gene is2-ΔΔCT. The hTERT mRNA expression of the placental in a normal term pregancy as standard, based on it, compare the hTERT mRNA relative expression in preeclampsia.4、Statistical methodUsing the mean±standard deviation (x±s) to express all data of immunohistochemical results, using variance analysis to many groups mean compares, the two sample mean compares using independent samples t test, inspection level was a=0.05. RT-PCR results through software SPSS13.0conduct covariance statistical analysis, inspection level was a=0.05, P<0.05have statistically significant.Result1、The placenta morphology research:Normal term placenta is given priority to syncytiotrophoblast, cytotrophoblast and villus syncytiotrophoblast nodules is rare, preterm placenta has more syncytiotrophoblast nodules. The placenta pathological changes of mild preeclampsia and normal pregnant women has no obvious difference, severe preeclampsia group placenta villus syncytiotrophoblast nodules significantly increased; cytotrophoblast hyperplasia significant; vascular reduce or congestion increases; fibrinoid necrosis of villus mesenchyme increased.2、the protein expression of hTERT(1) The orientation of hTERT and bFGF in placental tissue:The orientation of hTERT is mainly in the trophoblast cytoplasm, a few distributed in capillary vascular endothelial cell cytoplasm; bFGF is mainly distributed in the cytoplasm and nucleus of trophoblast. The average grey value of hTERT in term severe preeclampsia group(44.87±7.78) is higher than mild preeclampsia(52.87±7.16)and a normal pregnancy placenta (52.00±5.32) tropoblast(P<0.05), The average grey value of hTERT in preterm pregnancy group (63.78±12.20) is higher than preterm severe preeclampsia group (47.69±12.82)(P<0.05), there were no statistically significant differences between term mild preeclampsia and normal pregnancy group (P>0.05). The average grey value of bFGF in preterm severe preeclampsia group (74.36±12.32)is higher than the preterm pregnancy group(55.32±19.99)(P<0.05), there were no statistically significant differences between preterm severe preeclampsia and preterm pregnancy group (P>0.05).(3) RT-PCR:The expression of hTERT mRNA in preeclampsia1.4is significantly higher than normal pregnancy1.0(P<0.05), there were statistical significance; in severe preeclampsia placenta hTERT mRNA expression of1.64is higher than mild preeclampsia1.33, the defference has statistical significance (P<0.05).The expression of hTERT mRNA in the preterm severe preeclampsia placenta1.74is higher than the preterm pregnancy group0.88, the defference has statistical significance (P<0.05).Conclusion1. These pathology tissue change of severe preeclampsia group placenta is a proliferation reaction to oxygen defic.2. The expression of hTERT protein in the severe preeclampsia placenta was significantly lower than the control group, it infer that hTERT protein reduce may be the reason of preeclampsia placenta nourish cells abnormal invasion and cause nourish cells infiltrating.3. There were no obvious difference among the term mild preeclampsia group, term severe preeclampsia and term normal control group and has no obvious difference. It inferred that bFGF may not work in term placenta. The high expressionof bFGF in preterm severe preeclampsia placenta, speculate it may regulate the proliferation, differentiation and transfer of trophoblastic.4. The expression of hTERT mRNA in preeclampsia placenta was significantly higher, a high level of hTERT mRNA may be the telomerase reaction induced by placenta apoptosis.