| ObjectiveType 1 diabetes has been recognized as organ specific autoimmune disease owing to the immune destruction of pancreatic islet β cells in genetically susceptible individual. In both human and rodent models of type 1 diabetes, such as nonobese diabetic (NOD) mice,BioBreeding( BB) rats, the disease has a distinct stage characterized by immune cells infiltrate in the pancreas (insulitis). The major populations of infiltrating cells are macrophages and lymphocytes . Therefore, pancreatic islet immune cell infiltration may be a crucial step in the pathogenesis of type 1 diabetes. Monocyte Chemoattractant Protein -1 can specifically attract monocytes in vivo. Interferon induced Protein -10 has chemoattractant effects on the monocytes and activated lymphocytes. In this study, we will evaluate the expressions of MCP - 1 and IP - 10 in the pancreas of animal model of type 1 diabetes, NOD mice, and discuss hteir possible role in the pathogenesis of type 1 diabetes.Method1. Grouping the experimental animals and collect samples 1.1 Experiment NOD mouse that arose from ICR (Institute of Cancer Research) mice is an animal model of type 1 diabetes of humans. Around 4 weeks of age, the pancreatic islets infiltration of immune cells appeared and insulitis develops. Insulitis reach peak at about 9-10 weeks of age. The remaining pancreatic β cells decrease to no more than 10% of normal levels and diabetes be-gins. BALB/C mice were used as non - diabetes and non - autoimmune - prone control. Blood glucose of all of the mice was measured before death. If the blood glucose concentrations exceed 300mg/l, diabetes can be considered.1.2 Experimental group: NOD mice: 2,4,6,8,10,12,14 weeks of age, female, SPF grade, obtained from ShangHai Laboratory Animal Center, Chinese Academy Science.1. 3 Control group: BALB/C mice: 4 weeks of age, female, cleanness class, obtained from Faculty of Laboratory Animal, China Medical University1.4 The mice were killed by decollation. Pancreas were fixed in 10% formalin and embedded in paraffin. Paraffin - embedded tissues were sectioned and stained with hematoxylin - eosin and analyzed by light microscopy.2. Using Immunohistochemistry method to evaluate expression of MCP - 1 andIP-10.2. 1 Dewax sections, stain with immunohistochemistry Streptavidin biotin peroxidase complex ( SABC) method. Primary antibody is rabbit anti - mouse polyclonal antibody. The color of the complex is brown using 3,3'- Diaminoben-zidine tetrahydrochloride (DAB) kit(AR1022). Counterstain with Haematoxy-lin, dehydrate and mount, examine the slides microscopically.3. Immunoelectronmicroscope: The samples were fixed with 1% osmic acid after the color reaction using DAB. Sections were dehydrated in graded ethanol solutions and embedded in Epon 872. Ultra - thin(70nm) sections were made and stained with uranyl acetate, and then examined with JEM - 12Q0EX( JEOL) electron microscope.4.RT-PCR4. 1 Using TRIZOL one step method to withdraw total RNA from pancreas of NOD mice.4.2 According to the manual of TaKaRa RNA PCR Kit( AMV) Ver. 3.0 to operate. The primer of MCP -1 and IP -10 were based on the published reports as below.MCP-1 F: 5 ' - CTTCTGGGCCTGCTGTTCA -3 ' R:5 ' -CCAGCCTACTCATTGGGATCA-3 'IP -10 F: 5 - CCACGTGTTGAGATCATTGC -3'...
|
PDF Full Text Request