| BackgroudAs the most common cardiovascular diseases,hypertension is increasingly becoming a dominant public health problem in modern society mainly due to the sedentary lifestyle and over intake of fattiness,which can cause damages to organs such as heart,brain or kidney,etc.making these target organs fail to function and the morbidity and mortality are very high.Some researches show that as early as the initial stage of hypertension(within 2 years),remolding of the left ventricular and thickening of the left ventricular septal and the posterior wall already happened.With the progression of the hypertension,a spheric left ventricular cavity will develop successively.Left ventricular hypertrophy(LVH)caused by hypertension is an independt risk factor of the cardivascular disease,the more serious of the LVH,the more higher of the morbidity and mortality of the cardivascular disease.Therefore, how to prevent and reverse LVH is becoming an increasing concern of the public as well as the researchers.Among the studys ended on the LVH,there is still no consensus achieved on the mechanisms of LVH.In the past few years,some researchers found that the increasing load of blood stream dynamics or some factors of non-blood stream dynamics original,which could be harmful stimulations to the myocardium,can possibly activate some initial response gene such as the original cancer gene C-fos, Jun,myc,egy-1 by activating enzyme through signal transduction pathway,then the reciprocal transcription factors are synthesized,which can activate the transcription of sub-response gene such as the 5' end sequences of the muscle protein gene,lead to the increasing protein synthesis of the myocardial tissue and the the transformation of protein phenotype from normal-type to embryonic-type,which are typical representations of myocardial hypertrophy.Unfortunately,to our knowledge,the influence of long-term chronic over stimulation on the expression of NHE-1 gene is rarely known. Early in 1989,Sardet firstly cloned the human NHE-1 gene code and the partial 5' end non-translation sequence.Up to now,people have known that the NHE gene has 8 isoforms,named as:NHE1-8,all of them have highly homogeneities in terms of the gene structure and the amino sequence,and compose the gene family of the membrane exchange protein.They are different from each other in aspect of tissue and cell distribution,function and activity adjustment.The NHE-1 gene is the dominant isoform in myocardium,as a kind of steward gene,it locates at the protoplasmic membrane and maintains the stabilization of intracellular PH(Phi)by mediating the 1:1 exchange between extracllular sodium ion and intracellular hydrogen ion.Ohrol and colleagues reported that there is no hypertension developed in SHR at the age of 6 weeks,while of which the activity of Na+,H+ transportation is already as highly as the SHR with serious hypertension.Some researches also found that the activity of Na+/H+ exchange and the level of PHi within blood cells and / or tissue cells are abnormally elevated in patients with primary hypertension and in animals with hereditary hypertension.Some authors believe that it is due to the increasing expression of NHE-1 mRNA,which regulates the activity of the protein through increasing the quantity of the protein and speeds up the ion transportation,then the accelerated ion transportation causes the flow-in of Na+ and basification of the cytoplasm,which incents hyperplasia of the vascular smooth muscles,that hypertension develops.In this study,we hypotheses that the development of hypertensive left ventricular hypertrophy is associated with the elevated NHE-1 expression in myocardium,and we use the Fluorescence PCR technology to examine the the expression of NHE-1 gene by means of quantitatively detection of the NHE-1 mRNA in the myocardium of the SHR and WKY.The WKY are of normal blood pressure,and homogeneous and matched in age and body mass with the SHR.By this way,we explore the mechanism of the development of hypertensive left ventricular hypertrophy at the gene level,the results will provide implications on the experimental basis for the strategy making of treatment and prevention of hypertensive left ventricular hypertrophy.Objective1.To reveal the correlation between hypertensive left ventricular hypertrophy and the expression of the NHE-1 gene in spontaneously hypertensive rats.2.To explore the mechanism of the development of hypertensive left ventricular hypertrophy at the level of gene,and to provide implications on the experimental basis for the prevention of hypertensive left ventricular hypertrophy.Materials and Methods1.Animal Preparation20 spontaneous hypertensive rats(SHR)and 20 homologous rats of normal blood pressure,which matched in age and body weight with SHR,were provided by the experimental Animal Center of the people's hospital of sichuang province(permit number SCXK(111)2004-16),Male and female in half each respectively,10-11 week old,body weight 173-294g.All rats were raised in identical room environment, constant temperature of 22±3℃,constant humidity 60±5%,artifical illumination light and shade alternatively every 12 hours,taking food and water freely.The rats were weighted after fasting for 12 hours by electronic balance.2.Blood Pressure MeasurementPentobarbital sodium at a dose of 50mg/kg was injected into the abdominal cavity of the rats.and fixed on the animal shelf.A 20G fine catheter was placed into the abdomen aorta of the rats and the other end connected to the blood dynamics monitor(American Hewlett-Packard Company).After the zero calibration of the equipment,the blood pressure was determined and recorded at 1,2,3,4,5 and 6 minutes.The mean blood pressure was computed by the machine automatically. Four rats died of the puncture failure.3.Left Ventricular Weight/Body Weight Ratio(LVW/BW)As soon as the rats were executed,the hearts were taken out and washed repeatedly with the ice sodium chloride fluid,and the great vessels,the right ventricle and atrium were removed,the moisture was extracted with the filter paper, the left ventricular was weighted to obtain the LVW/BW for evaluating the degree LVH.4.Determination Of the Level Of The NHE-1 mRNA In Myocardium By The Real-time Fluorescence PCR Technology4.1 SpecimenSelected a piece of myocardium to put into a frozen test tube of 1.5ml,then kept in the refrigerator of -80℃for pre-emergency.4.2 The Preparation Of Total RNA In MyocardiumUsing the method of guanidinium isothiocyanate,the content and purity of RNA were detected by ultraviolet spectrophotometry,the integrity of DNA was detected by denatured electrophoresis of 1%formaldehyde gelation.4.3 Synthesis of the DNA Fragment By Reverse Transcription(RT)1.5ug of RNA in myocardium was extracted for cDNA synthesis.(reverse transcription response refer to the description of the kit of RevertAid H Minus First Strand cDNA Synthesis).4.4 The Design Of The Primer Of Quantitative Fluorescence PCRThe primers of the NHE-1 and GAPDH were designed by the software of Primer Express 2.0 provided by ABI corporation,all primers were synthesized and provided by the TaKaRa corporation of Japanese.the sequence of the primer is as follow: NHE-1 Realtime PCR Primer,Forward:GGAAACAAGACGGGTGACCTAT, reverse:CTGCAGCTCCGAGTAAGGA,TaqManprobeSequence:CACGGTTCTCCC ACTAGCCTCGGTG;Rat GAPDH Real time PCR Primer,Forward:TGGTGCCAA AAGGGTCAT,REVERSE:TCACACCCATCACAAACATG,the TaqManprobe: Sequence:5-FAM -CCCCTTCCGCTGATGCCC-3'-TAMRA;t he ordinary primers is prepared GAPDH and standard GAPDH,Sequence:5'-GGCAAGTTCAATGGCA CAGT-3',5'-AAGGTGGAGG AATGGGAGTT-3'4.5 The Preparation Of The Standard Of The Quantitative Fluorescence PCRcDNA was obtained by reverse transcription from total RNA from the myocardium sample,and amplified with a pair of primer of NHE-1 and GAPDH.(the reaction system refer to the description of the TaqTM PCR Kit provided by the TaKaRa corportation of Japan).4.6 The Recycling Of The Gelatin Of The PCR ProductThe content of the recycling DNA was detected by Eppendorf,and stored at -20℃.4.7 The Connection Of T-CarrierReference to the Japanese Takara company pMD 18-T Vector product brochures.4.8 DNA Plasmid Was Transformed Into Escherichia Coli4.9 Preparation Of A Small Amount Of Plasmid DNA4.10 The Computation Of The Standard Absolute Copy Number And The Schema Of Gradiet Dilution150 ug/ul NHE-1 and 190 ng/ul GAPDH recombinant plasmid were first diluted to 1×1010copy/ul,followed by 10-fold dilution to 109 and 103 copy/ul.4.11 Quantitative Fluorescence PCR ResponseReal-time quatitative PCR refers to the description of the TaqMan universal PCR Master Mix.the condition for response:95℃for 10 min,95℃for 15 sec,58℃for 30 sec,72℃for 30see,a total of 40 cycles,after Step 2 of each cycle the fluorescence detection was completed.Add the samples into holes as described above, there were three duplicate holes for each sample,then put the samples on the fluorescence quatitative machine,the responses were proceeded according to the set procedures,real-time data were acquired and quantitatively analyzed by software Strategen MX 3000p.5.Statistical AnalysisAll data are analyzed by statistical software SPSS11.5,results are expressed by mean±standard deviation((?)±s).the rats weight,averaged blood pressure,left ventricular mass,left ventricular weight / body weight ratio and the NHE-1 mRNA expression of myocardial tissue of the two groups are compared with the t test,the correlation between rat averaged blood pressure and left ventricular weight,mean blood pressure and left ventricular weight / body weight ratio,NHE-1 mRNA gene copy number of rat myocardial tissue and left ventricular weight / body weight ratio are compaired by using pearson correlation analysis,fixed p value＜0.05(bilateral)is taken as difference with statistical significance.Results1.The mean blood pressure in SHR group was 111.39±13.95mmHg,WKY group 86.89±6.31 mmHg,t=6.783,P＜0.000,there was a significant difference between the two groups of SHR and WKY.2.The mean body weight in SHR group was 232.89±45.99g,WKY group 219.79±23.39 g,t=1.078,P=0.291,there was no significant difference in the mean body weight between SHR and WKY group.3.The mean left ventricular weight in SHR group was 0.58±0.18g,WKY group 0.46±0.71 g,t=2.702,P=0.013,there was a significant difference in the mean left ventricular weight between the SHR and WKY.Left ventricular weight / body weight ratio in SHR group was 2.46±0.38 mg/g,the WKY group was2.08±0.20 mg/g, t=3.671,P=0.001,there was a significant difference between the two groups.4.The NHE-1 mRNA's copy number in the myocardium in SHR group was (10.9±10.8)×10-2cycle/ul,and WKY(2.7±4.1)×10-2cycle/ul,t=3.005,P=0.007, The difference between the two groups had a statistical significance.5.The correlations between mean blood pressure and left ventricular weight in the SHR and WKY groups were calculated by Pearson correlation analysis,correlation coeffcient r= 0.700,p＜0.000,there was a positive correlation between mean blood pressure and left ventricular weight of the rats.6.The correlation between mean blood pressure and left ventricular weight / body weight ratio in rats was tested by Pearson relevance analysis,the correlation coeffcient r=0.617,p＜0.000,result showed the mean blood pressure was positively correlated with left ventricular weight / body weight ratio.7.The correlation between the copy number of NHE-1 mRNA in myocardium and the left ventricular weight was tested by Pearson correlation analysis,correlation coeffcient r=0.374,p=0.025,the copy number of NHE-1 mRNA in myocardium was positively correlated with the left ventricular weight.8.The correlation between the copy number of NHE-1 mRNA in myocardium and left ventricular weight / body weight ratio was tested by Pearson correlation analysis, correlation coeffcient r=0.514,p=0.01,the copy number of NHE-1 mRNA in myocardium was positively correlated with the ratio of the left ventricular weight and body weight. Conclusions1.Comparing with the WKY group,the LVW and LVW/BW in the SHR group are significantly increased,correlation analysis shows that mean blood pressure is positively correlated with left ventricular weight / body weight ratio,it suggests that the extent of myocardial hypertrophy in SHR group is heavier than that in the WKY group.2.The expression of NHE-1 mRNA in the myocardial tissue in SHR group is increased,the NHE-1 mRNA copies of rat myocardium and left ventricular mass and left ventricular weight / body weight ratio are positively correlated,it suggests that NHE-1 may play an important role in the occurrence and development of myocardial hypertrophy.
|
PDF Full Text Request