[Background]Prostate cancer (PCa) is the most common malignant tumor in the male reproductive system. The disease incidence of male cancer ranks the first one. and the mortality ranks the first two in the Europe and the United States. Although the incidence of PCa in China is far lower than Europe and the United States, However, with the lifestyle changes, population aging and PSA are widely used in screening, The incidence of PCa was significantly rise in recent years.A national study of PSA screening found that the rate of Prostate cancer for those over age 50 was 0.78%. This suggests that the actual incidence rate of prostate cancer is not low in China. Therefore, search an effective treatment for prostate cancer has become a pressing public health problem worldwide.Most protein in organism exist in the form of glycoprotein, sugar chains of glycoprotein affect its functions directly. Structural changes in N-glycans are one of the critical steps in cellular malignant transformation. It is well known that the structures of complex carbohydrates are altered in cancer and that these changes are highly associated with invasion and metastasis. N-Acetylglucosaminyltransferases V (GnT-V) play a pivotal role in the processing of N-linked glycoproteins, and are highly involved in cancer progression and metastasis. GnT-V catalyzes the formation of GlcNAc-β1-6 branches at the Man al-6 side of the trimannosyl core of N-glycans. These branches are abundant in cancer tissues, especially in those with high metastatic potential.Gene therapy is a promising cancer treatment. RNA interference (RNAi) is a new gene function research tools, which developed rapidly in recent years。RNAi is a sequence-specific post-transcriptional gene silencing in widespread organisms triggered by double-stranded RNA (dsRNA), namely, siRNA, which is homologous with target gene sequence. Transfected target cells, promoting the target gene mRNA degradation, Thereby inducing specific post-transcriptional gene silencing. SiRNA corresponding to the template will be double-stranded DNA sequence was cloned into a plasmid transfected cells, DNA template transcribed in the cell into the shRNA, With chemically synthesized siRNA has the same closure of the role of genes. But the role of time can be up to 2 months。Because of its specificity and efficiency, RNAi become a hot spot of cancer gene therapy.In this study, we adopted RNAi to inhibit the expression of GnT-V, constructed expression vectors of small haired RNA aimed at GnT-V gene, which was higly expressed in prostate cancer. Then transfected these vectors into high metastatic potential PC-3 cell line, observed the expression of GnT-V in PC-3 cells transfected by RNAi, and explored the valid RNAi sequence. By this way, it could provide experimental basis for identify new target in molecule-targeting treatment of prostate cancer.[Methods]1,Construction and identification of pGPU6/GFP/Neo GnT-V shRNA(1) GnT-V siRNA sequence design:According to siRNA design principle, we designed RNA fragments aiming at GnT-VcDNA (NM002410.3). sequence information as follows:GnT-V/1079 sense 5'GGAAGTGCATGCAACTGTTTA 3'. To design a negative control siRNA, scramble the nucleotide sequence of the gene-specific siRNA and conduct a Blast contrast to make sure it lacks more than 70 % homology to any other gene. Negative control sequence information as follows: sense 5'GTTCTCCGAACGTGTCACGT 3', naming it GnT-V/NC. The siRNA was chemically synthesized by the Zimmer company (Shanghai). (2) shRNA transcriptional template DNA design:According to designed siRNA sequence, we designed template DNA oligonucleotides, the order of sequence as follows:Bbsâ… restriction site, sense sequence,9nt loop sequence, antisense sequence, RNA polymeraseâ…¢termination(6 nucleotide poly T), BamHâ… restriction site.(3) Construction and identification of pGPU6/GFP/Neo GnT-V plasmid:To construct recombinant plasmid, we annealed the two siRNA template oligonucleotides of each group, and ligated annealed siRNA template insert into pGPU6/GFP/Neo, then transformed E. coli DH5 a with the recombinant plasmid, picked Kanamycin resistant colonies and isolated plasmid DNA, digested the plasmid with Bbsâ… and BamHâ… , sequenced with U6 primers to verify that the clone contains the insert, and that it is the desired sequence. Then expanded colonies, extracted and purified pGPU6/GFP/Neo GnT-V plasmid for transfection.2,Cell culture and transfectionHuman prostate cancer cell line PC-3 was cultured in RPMI-1640 containing 10% newborn cow serum, in the condition of 37℃5%CO2. When PC-3 cells were cultured to exponential growth phase, Lipofectamine 2000TM was used to transfect recombinant plasmids into PC-3 cells.3,Examination of interfered effects(1) The mRNA expression of GnT-V were measured by semi-quantitative reverse transcription polymerase chain reaction(RT-PCR).After the success of transfection, continue to foster PC3 cells for 48h, then collected cells. Total RNA was isolated from cells and converted into cDNA by using hexamer random primers. N-Acetylglucosaminyltransferase V cDNA was amplified by using the primers 5'AACTCTTGGACCATCCTGGGTTC3' and 5'TTGCTGCTTTTGGGTGGGTT3', which generated 555bp products. To normalize the efficiency of the amplification,β-actin cDNA was amplified by using the primers 5'GAAACTACCTTCAACTCCATC 3'and 5'CGAGGCCAGGATGGAGCCGCC 3', which generated 219bp products. They were amplified by 30 cycles of 94℃for 30 s, 40℃for 30s and 72℃for 30s.(2) The protein expression of GnT-V were measured by Western blot analysis.After the success of transfection, continue to foster PC3 cells for 72h. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride (PVDF) membranes. The blots were blocked with 5% defatted milk for 1h at room temperature and then probed with goat anti-human antibodies against GnT-V (1:200) and mouse anti-human antibodies against GAPDH(1:1000) for lh at room temperature, respectively. After three washes, the blots were subsequently incubated with rabbit anti-goat peroxidase-conjugated secondary antibody(1:400) and rabbit anti-mouse peroxidase-conjugated secondary antibody (1:9000) for 1h at room temperature, respectively. The blots were visualized by enhanced chemiluminescence using Fuji super RX film (Fuji film, Tokyo, Japan).4,The effects of pGPU6/GFP/Neo GnT-V shRNA vectors on proliferation, adhesion, migration and invasion of PC-3 cell line(1)Cell proliferation was evaluated by CCK-8 assay:Cells were cultured to exponential growth phase, CCK-8 assay was used to analyze cell activity at different times(0h,24h,48h,72h,96h), eight replicates were measured at each time. Cell growth curves were portrayed by using OD450nm value of each group, and calculated growth inhibitory rate of interfered group. Cell growth inhibitory rate(IR)=(OD450 value of negative control group—OD450 value of interfered group)/OD450 value of negative control group×100%.(2) Heterogenous adhesionCells were cultured to exponential growth phase, each group set up 24 replicates. Cells were cultured in the absence of newborn cow serum for 24 hours. Microtiter plates with 96 wells (Coring) were coated with Matrigel gel (50μL/well). The wells were subsequently washed twice with PBS solution, and then blocked with 1% BSA (Sigma)/PBS at 37℃for 2 h. Cells were detached from culture dishes by dissociation buffer, seeded at a density of 5×103 cells/well in 100μL of medium, and then incubated at 37℃for 1h. The assay was terminated by washing with PBS to remove unbound cells. The attached cells were measured with CCK-8 assay.(3) Chemotactic migrationThe inhibitory effect of RNAi on migration and invasion of PC-3 cells in vitro was assayed using 24-well Transwell cell culture chambers(6.5 mm diameter,8.0μm pore size, polycarbonate membrane, Corning). Cells were cultured in the absence of newborn cow serum for 24 hours.10% newborn cow serum was chosen as chemotactic factor. Results are shown as the number of cells that had migrated through the polycarbonate membranes by counting 5 randomly chosen HPF under light microscopy(400x) for each replicate.(4) Wound closure assayCells of exponential growth phase were plated onto Collagenâ…£coated wells, and were cultured to grow to monolayer. Linear scrape wounds were made on the cell monolayers, and cultured in the presence of 10% newborn cow serum. The wounds were allowed to heal for 36 hours. Pictures of wound heal were taken in 4 randomly chosen HPF under light microscopy for each replicate at Oh,12h,24h and 36h respectively(240x), wound cure rate=(distance of linear scrape wounds before healing—distance of linear scrape wounds after healing)/distance of linear scrape wounds before healing×100%.(5) Cell invasive experimentCells of exponential growth phase were cultured in the absence of newborn cow serum for 24 hours.24 well Transwell cell culture chambers and matrigel gel were used to examine cell invasion. The number of cells that had penetrated through the matrigel gel and polycarbonate membranes were determined by counting 5 randomly chosen HPF under light microscopy(400x) for each replicate.[Statistical analysis]Statistical analysis was performed by using the program SPSS 13.0, The experimental data was showed with x±s. Statistical analysis between two samples was performed using Student's t-test. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA). In all statistical tests, A probability level of P<0.05 was accepted as statistically significance。[Results]1,Identification of recombinant plasmidDigested the recombinant plasmid pGPU6/GFP/Neo GnT-V/1079,pGPU6/GFP/Neo GnT-â…¤/NC with Bbsâ… and BamHâ… , digestion products were checked by electrophoresis, results show that target fragment were inserted to recombinant plasmid successfully. Sequence analysis also verified the insert is the desired sequence. GnT-V shRNA expression plasmid was constructed successfully.2,Stable transfection of siRNAPlasmid pGPU6/GFP/Neo contains the coding sequence of Green Fluorescent Protein gene, so stably transfected cells can emit green fluorescence by fluorescence microscopy. Fluorescence microscopy detection showed that recombinant plasmids were stably transfected to PC-3 cell line successfully.3,Influence of GnT-V shRNA expression vectors on GnT-V mRNA expression and GnT-V protein expressionThe mRNA expression of GnT-V was evaluated by semi-quantitative RT-PCR, The protein expression of GnT-V was analyzed by immunoblotting with anti-GnT-V antibody. The level of mRNA and protein expression of GnT-V/1079 decreased by 76.5% and 67% respectively, it means depress the PC-3 cells obviously. Compared to negative control group, it has statistically significant difference (P<0.001).4,Influence of GnT-V shRNA expression vectors on cell proliferationCell growth curves were portrayed by using OD450nm value of different times(0h,24h,48h,72h,96h), and calculated growth inhibitory rate of PC-3 GnT-V/1079. CCK-8 assay showed proliferation of PC-3 GnT-V/1079 was inhibited obviously (P<0.001), especially in 48h.5,Influence of GnT-V shRNA expression vectors on adhesion, migration and invasion Down-regulation of GnT-V expression can enhance adhesive ability (t=—2.361, P<0.05) and inhibit chemotactic migration (t=15.057, P<0.001) in PC-3 cell line; The wound closure assay also indicated that down-regulation of GnT-V expression can significantly prolong wound heal hours of PC-3 cell line; Cell invasive experiment using matrigel gel showed that penetrative cell numbers of PC-3 GnT-â…¤/1079 and PC-3 GnT-V/NC were 6.20±1.70 and 37.90±3.46 respectively. The results showed that penetrated PC-3 GnT-â…¤/NC cells through the Matrigel gel and polycarbonate membranes are much more than PC-3 GnT-V/1079 (1=36.733, P<0.001). It also means down-regulation of GnT-V expression can significantly inhibit PC-3 cell invasion.[Conclusion]1,The shRNA expression vectors aimed at GnT-V gene in prostate cancer PC-3 cells can down-regulate the expression of GnT-V both in the level of mRNA and protein obviously.2,Down-regulation of GnT-V expression can significantly inhibit proliferation, migration and invasion of PC-3 cell line in vitro.3,The optimal GnT-V siRNA sequence segment may be provides a valid target for treating prostate cancer.
|