Font Size: a A A

The Effect Of Different Factors On Semen Quality Of Blue Fox And Construction Of The Luciferase Reporter Vectors Of Silver Fox MC1R Promoter

Posted on:2016-03-21Degree:MasterType:Thesis
Country:ChinaCandidate:L ZhangFull Text:PDF
GTID:2283330464466953Subject:Farming
Abstract/Summary:
The first part: The Effect of Different Factors on Se men Quality of Blue FoxArtificial Insemination technique can improve the utilization of male foxes, and accelerate the improvement of fine foxes. This study was to explore the effect of the optimum storage temperature in vitro, the optimum semen collection frequency and the optimum dilution on the semen quality and body weight of blue fox. The research achievements will be able to provide some references for the rational utilization of male fox and the improveme nt of semen quality. Forty- four same size, age-matched blue foxes were randomly selected from the reserve male foxes, and they were divided into 4 groups with 10 in each group, and the eleventh fox may serve as alternative options.The screening of the optimum semen collection frequency: According to different semen intervals(semen collected at 1 time interval 1 day, 2 times interval 1 day, 3 times interval 2 days and 1 time interval 2 days), the semen of all the laboratory animal were collected, and the semen quality and changes of body weight were analyzed in detail. The results showed that the fourth group was the highest in ejaculate volume, sperm motility and sperm density, and had obvious difference between the fourth group and the other three groups(p<0.05).The screening of the optimum storage temperature in vitro: The diluted semen was divided into 4 groups, and the semen of each group was stored on room temperature, 4℃, 10℃ and 17℃, respectively. After storage 12 hours, 24 hours, 36 hours, 44 hours and 50 hours, the sperm motility was detected. The results showed that there were significant effects on sperm motility after storage 12 hours and 24 hours(p<0.05). The sperm motility was the highest when the semen stored on 10℃. There were significant effects on sperm motility after storage 36 hours, 44 hours and 50 hours(p<0.05). The sperm motility was the highest when the semen stored on 4℃ in three time periods.The screening of the optimum dilution: Semen diluted with one foreigndilution and six self- made dilutions were stored on 4℃. After storage 0 hour, 12 hours, 24 hours, 36 hours and 48 hours, the sperm motility was detected. The results showed that the third group was the highest in sperm motility after storage 0 hour, and had obvious difference between the third group and the other six groups(p<0.05). The third group was also the highest after storage 12 hours, there were significant difference between the third group and the fifth, the sixth and seventh group, respectively(p<0.05). The fourth group was the highest after storage 24 hours, there were significant difference between this group and the seventh group(p<0.05). The third group was the highest after storage 36 hours, there were significant difference between the fourth group and other five groups except for the first group(p<0.05). The first group was the highest after storage 48 hours, there were significant difference between the first group and other six groups(p<0.05).The second part: the Construction of the Luciferase Reporter Vectors of Silver Fox MC1 R PromoterTaking silver fox as research object, the promoter region sequences(2781bp) of MC1 R gene were obtained by using the method of PCR amplification and sequencing. The alignment showed that an identity of 93.97% between this sequence and that of dog, suggesting that the obta ined sequence were promoter region sequences of silver fox MC1 R gene. Through the prediction of online tools(Neural Network Promoter prediction), four core promoters :(AAGTAC TGTCTGTAACAGACGGGAGATTCC CAGTGTGGTC TGTATTCTTG、TGAATTCTAAAATAGGTAAAATGGGCAGC CCTGGTGGC TC AGC AGTTTGG、ATGTACTTCAATAAGAAGCACCGTCCAA GGGGGGGAAGCC GCCTTGCTGA and GATTTGCAGTATATTTAGGGGACCC CACATAGGCAGATAC TGGGAGCGG) were found on the promoter region of silver fox MC1 R gene. Transcription initiation sites were located at-1964bp、-1834bp、-1414 bp and-596 bp upstream of MC1 R coding region, respectively. According to promoter prediction results of silver fox MC1 R gene, 10 promoter fragments of different length and position were selected and 10 pairs of primer weredesigned. Then, taking cloning products of 2781 bp fragment as templates, PCRamplifications were completed. The results showed that the ten promoter fragments with different length and position were successfully cloned into luciferase reporter gene PGL-3 Basic, respectively. They were as follows: p GL3-Basic(1-2781), p GL3-Basic(459-2781), p GL3-Basic(647-2781), p GL3-Basic(794-2781), p GL3-Basic(1180-2781), p GL3-Basic(1502-2781), p GL3-Basic(1681-2781), p GL3-Basic(1944-2781), p GL3-Basic(2189-2781) and p GL3-Basic(2441-2781). The results laid the experimental foundation to further verify and study the promoter activity and the transcriptional regulation of fox MC1 R gene.
Keywords/Search Tags:Blue fox, Artificial insemination, Semen collection frequency, In vitro preservation, Diluent, Body weight, Silver fox, MC1R, PCR, Core promoter, Luciferase reporter gene
Related items